Detailed Information on

WiscDsLoxHs T-DNA Lines

(This information does NOT apply to WiscDsLox lines.  It only applies to WiscDsLoxHs lines.)

Click here for a summary of the differences between WiscDsLox and WiscDsLoxHs.

The T-DNA vector used to construct WiscDsLoxHs T-DNA lines was derived by modifying pYS11 (Nishal et al, 2005).   pYS11 was constructed by the laboratory of Venkatesan Sundaresan and has been demonstrated to effectively function as a Ds transposon launchpad.  A unique feature of pYS11 is that it carries a copy of the Ac transposase gene under the transcriptional control of a heat shock-inducible promoter (Nishal et al, 2005).  Because of this situation, one is able to mobilize the Ds element present in WiscDsLoxHs lines by subjecting the lines to a controlled regimen of heat shock during growth (Nishal et al, 2005).  In the absence of heat shock, the Ds element should not mobilize (Nishal et al, 2005). 

The only difference between the pYS11 vector described by Nishal et al and the pDsLoxHs vector used to create WiscDsLoxHs lines is the presence of two LoxP sites in the pDsLoxHs vector.  One of these LoxP sites is located near the Left Border of the T-DNA vector, and the second LoxP site is contained within the Ds element.  After excision of the Ds element, the LoxP site within the Ds element will travel to a new region of the genome with the Ds element.  The LoxP site near the Left Border is not affected by the excision event, however, and remains in its original location.

How to mobilize the Ds transposon   A detailed description of how to mobilize the Ds element in WiscDsLoxHs lines can be found by reading the original paper from the Sundaresan lab describing the use this heat shock inducible Ac system (Nishal et al, 2005). 

How to perform a targeted deletion  In order to perform a targeted deletion of a segment of the genome, one must mobilize the Ds element present in a given T-DNA line so that the region of interest becomes flanked on one side by the original T-DNA insertion and on the other side by the re-inserted Ds element.  In addition, one must also confirm that the LoxP sites are present in a head-to-tail orientation in the genome.  Mapping the orientation can be performed using PCR primers specific to the unique border sequences of the T-DNA vector and the Ds transposon.  Such primer sequences are shown on the vector map and described in detail below.  Once a line has been isolated that meets these criteria, then the final step of the process is to cross this line with a plant that expresses the Cre recombinase.  Arabidopsis lines expressing Cre recombinase are available from the ABRC stock center under the stock number CS859433, CS859434, and CS859435. These lines were originally produced by the laboratory of Nina Fedoroff and are described in this publication (Zhang et al, 2003).  Details of the procedures for generating and identifying targeted deletions using a Cre-Lox system in Arabidopsis can also be found in that publication. 

PCR primer to use for Ds re-insertion mapping:

DS-1    5'-GAGTACAATCAATTTTCCTTGTGGACTTG-3'

PCR primer to use for T-DNA insert mapping:

L4        5'-TGATCCATGTAGATTTCCCGGACATGAAG-3'

Orientation of the LoxP sequences as shown in the figure on this webpage:

5'-ATAACTTCGTATAGCATACATTATACGAAGTTAT-3'

The vector used to create WiscDsLoxHs lines is called pDsLoxHs.  The complete

sequence of the vector has not been determined.  The sequence of the Left Border

region of the vector is as follows:

5'-TACGACGGATCGTAATTTGTCGTTTTATCAAAATGTACTTTCATTTTATAATA

ACGCTGCGGACATCTACATTTTTGAATTGAAAAAAAATTGGTAATTACTCTTT

CTTTTTCTCCATATTGACCATCATACTCATTGCTGATCCATGTAGATTTCCCGG

ACATGAAGCCATTTACAATTGAATATATCCTGCC-3'

Sequence surrounding the LoxP site within the Ds element (LoxP site highlighted in red):

5'-TCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAG

CATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGA

AAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGA

CGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATC

ACGAGGCCCTTTCGTCTTCAAGAATTCGAGCTCGGTACCCCTAGACTAGTACC

CACGTCCGAACACTTGATACATGTGCCTGAGAAATAGGGTACCTAATAACTT

CGTATAGCATACATTATACGAAGTTATATGGATCTATATGTTTTTCGTCTCAG

CCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGAC

AACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAA

GGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCC

ATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAA-3'

Sequence surrounding the LoxP site located near the heat shock promoter (LoxP site highlighted in red):

5'-CAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAG

AAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCC

CTTTCGTCTTCAAGAATTCGAGCTCGGTACCCCTAGACTAGTACCCACGTCCG

AACACTTGATACATGTGCCTGAGAAATAGGGTACCTAATAACTTCGTATAGC

ATACATTATACGAAGTTATATGGACTAGTCAGCCTTTTAAGAGATAGAATTTA

AAATATAATTTGCGTAAAACATTATTAAAAATACAAATTTATAAATTAAGTTC

AACTCATCCTATCTCACTCTTTAAATACGATGTTTACTTATTAGACTCATTAAT

TGGTAGACCAATCCTAACCAATGTCTGGTTAAGATGGTCCAATCCCGAAACTT

CTAGTTGCGGTTCGAAGAAGTC-3'